Commit 958ae5c0 authored by cev's avatar cev

Changing libs path in tests

parent 34d18e85
......@@ -7,7 +7,7 @@ import mirmap.if_clib_phast
class TestPhast(unittest.TestCase):
def test_get_exact_prob(self):
lib = mirmap.if_clib_phast.Phast(library_path='libs/compiled')
lib = mirmap.if_clib_phast.Phast(library_path='libs/default')
aln = open('tests/input/NM_024573_ts1.fa').read()
result = lib.phylop(method='SPH', mode='CONACC', mod_fname='tests/input/NM_024573.mod', aln=aln, aln_format='FASTA', prune=True)
self.assertAlmostEqual(0.590965154, result)
......@@ -8,7 +8,7 @@ import mirmap.if_clib_rna
class TestRNAvienna(unittest.TestCase):
def test_fold(self):
seq = 'AUCGAUGCGAUCGAGGGGCGCCCUUAAAGCUCUGAGGCGGCCCCCCA'
lib = mirmap.if_clib_rna.RNAvienna(library_path='libs/compiled')
lib = mirmap.if_clib_rna.RNAvienna(library_path='libs/default')
lib.init_pf_fold(len(seq))
struc_buffer = lib.get_string_buffer(len(seq))
result = lib.pf_fold(seq, struc_buffer)
......
......@@ -7,6 +7,6 @@ import mirmap.if_clib_spatt
class TestSpatt(unittest.TestCase):
def test_get_exact_prob(self):
lib = mirmap.if_clib_spatt.Spatt(library_path='libs/compiled')
lib = mirmap.if_clib_spatt.Spatt(library_path='libs/default')
result = lib.get_exact_prob('AUUAAAA', 1, 1000, ['A', 'U'], [0.1780821917808219, 0.821917808219178, 0.6593406593406593, 0.34065934065934067], 1, 'o')
self.assertAlmostEqual(0.3704134091486, result)
Markdown is supported
0% or
You are about to add 0 people to the discussion. Proceed with caution.
Finish editing this message first!
Please register or to comment