plaster error generating pangenome

I have installed plaster and then examples work just fine - great. However, when I try to use it on my own fasta files it doesnt seem to not work.

I have put all my sequnces is seperate .fasta files like myfas.fasta.

The fasta files typically look like, which seems to match the example files

>736en atgttttcccagtcacgacgttgtaaaacgacggccagtcttaagcgtctcatggcctgaccccggaccaagtggtggcctatcgccagcaacattggcggcaagcaagcgctcga

They are in the current working directory e.g.:

ls -u | head -2

736en.fasta eakff.fasta

I am then running the following at the command line:

plaster *.fasta -o ~/data/pangenome -r

where I get the following error:

plaster: error: argument -a/--align-only: ignored explicit argument 'y337.fasta'

y337.fasta is not one of my files as all my fasta files have a 5 alpha-numeric identifier, so not sure what's going on here. Any help to debug would be excellent.