Commit 3995d34c authored by harm's avatar harm
Browse files

update documentation

parent 2c162ba7
################################################################################
### README #####################################################################
If you are using our software, please cite:
Hans-Hermann Wessels, Alejandro Méndez-Mancilla, Xinyi Guo, Mateusz Legut, Zharko Daniloski, Neville E. Sanjana.
Massively parallel Cas13 screens reveal principles for guide RNA design. Nature Biotechnology (2020). doi:10.1038/s41587-020-0456-9
https://www.nature.com/articles/s41587-020-0456-9
This R-script software serves to predict guides for RfxCas13d Type-IV CRISPR proteins to maximize knock-down efficiencies.
Guide efficacies are modeled after an on-target tilling screen against GFP, CD46, CD55, and CD71 mRNA.
### Installation ###############################################################
You have already unpacked Cas13design.tar.gz
tar -xzf Cas13design.tar.gz
Unpacking Cas13design.tar.gz will create a Cas13design directory, as well as scripts and data sub-directories.
The main executable RfxCas13d_GuideScoring.R can be found within the scripts sub-directory.
External RNAfold and RNAplfold binaries v2.4.10 are included. RNAhybrid may be installed and added to your $PATH (see below).
All R packages needed will be automatically installed within the scripts folder upon the first execution.
This may increase the runtime of the first run by several minutes. We recommend using R v3.6 or newer to execute RfxCas13d_GuideScoring.R.
If older R versions are used, the Bioconductor package Biostrings may need to be installed manually via BiocLite.
Model input data as well as an example input fasta file are included within the data sub-sirectory.
Next, please install RNAhybrid.
The source code can be downloaded here:
wget https://bibiserv.cebitec.uni-bielefeld.de/applications/rnahybrid/resources/downloads/RNAhybrid-2.1.2.tar.gz
copy RNAhybrid-2.1.2.tar.gz into ./Cas13design/scripts/ and unpack RNAhybrid
cp RNAhybrid-2.1.2.tar.gz ./Cas13design/scripts/
cd ./Cas13design/scripts/
tar -xzf RNAhybrid-2.1.2.tar.gz
cd RNAhybrid-2.1.2
Follow the installation instructions for RNAhybrid in INSTALL:
If you install it on your local system and you have sudo rights, do:
./configure
make
make install
If you install it e.g. on a cluster without sudo rights you can follow this:
./configure --prefix=$HOME #this will create a bin folder in your $HOME directory
make
make install
export PATH=$HOME/bin:$PATH # You may want to add this to your ~/.bashrc or ~/.bash_profile
Make sure RNAhybrid has been added to your PATH
which RNAhybrid # should return ~/bin/RNAhybrid
The Software will assume RNAhybrid is in ~/bin/
All other dependencies are included in the Cas13design.tar.gz archive
### Guide Prediction ###########################################################
To predict guide RNA efficacies simply call RfxCas13d_GuideScoring.R with its three required input arguments in order. In its current implmentation, the script will run successfully only within its main directory Cas13design.
cd Cas13design
Rscript <script.R> <input fasta> <model input> <plot logical>
The input fasta file should contain a single entry.
Running multiple prediction is faster, if separate instances are coerced.
The fasta header contains its name. Additional information is expected to be separated by "|". CDS coordinates, if present, should be provided in the following format within the fasta header (e.g. CDS:171-2453). These coordinates only become relevant, if you desire to plot guide predictions along cds-containing transcripts.
Run the example data:
Rscript ./scripts/RfxCas13d_GuideScoring.R ./data/test.fa ./data/Cas13designGuidePredictorInput.csv true
If you run the script the first time, R package installation may take several minutes.
Once Cas13design is fully installed, the run time scales with the fasta input length.
The minimum length supplied must be at least 30 nucleotides. The total run time for the provided ~1000nt test.fa example is about 2 min and 10 sec.
### Expected outputs ###########################################################
The output may be 3-fold and named after the fasta header information:
1) A fasta file with guide sequences (reverse complement to the target sequence).
The header includes the following information separated by underscores "_"
the crRNA number (5' to 3') and match position (e.g. crRNA1156:1399-1425)
standardized guide score
rank
quartile according to input screens
2) A csv file containing all predicted guides
3) if plot was set to TRUE, a pdf file is returned depicting the score destribution along the target transcripts
Guide scores range between a 0 - 1 interval, with higher scores being indicative for higher predicted knock-down efficacy.
# Additional information
For more information, please refer to our manuscript.
################################################################# /README ######
################################################################################
################################################################################
### COPYRIGHT ##################################################################
# New York Genome Center
# Copyright (c) 2019 Hans-Hermann Wessels and Neville Sanjana.
# Released under BSD 3. See LICENSE file for details.
# If you're interested in getting access to this system under a different license, please contact us.
# Version: 0.2
# Author: Hans-Hermann Wessels
################################################################# /COPYRIGHT ###
################################################################################
File mode changed from 100644 to 100755
File mode changed from 100644 to 100755
File mode changed from 100644 to 100755
../../data/LetterFreq.csv
\ No newline at end of file
File mode changed from 100644 to 100755
File mode changed from 100644 to 100755
File mode changed from 100644 to 100755
File mode changed from 100644 to 100755
File mode changed from 100644 to 100755
File mode changed from 100644 to 100755
>Coronavirus.MN908947_NY1-PV08001.3pUTR_polyA
caatctttaatcagtgtgtaacattagggaggacttgaaagagccaccacattttcaccgaggccacgcggagtacgatcgagtgtacagtgaacaatgctagggagagctgcctatatggaagagccctaatgtgtaaaattaattttagtagtgctatccccatgtgattttaatagcttcttaggagaatgacaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa
>Coronavirus.MN908947_NY1-PV08001.5pUTR_ORF1ab
attaaaggtttataccttcccaggtaacaaaccaaccaactttcgatctcttgtagatctgttctctaaacgaactttaaaatctgtgtggctgtcactcggctgcatgcttagtgcactcacgcagtataattaataactaattactgtcgttgacaggacacgagtaactcgtctatcttctgcaggctgcttacggtttcgtccgtgttgcagccgatcatcagcacatctaggtttcgtccgggtgtgaccgaaaggtaag
>Coronavirus.MN908947_NY1-PV08001.E
atgtactcattcgtttcggaagagacaggtacgttaatagttaatagcgtacttctttttcttgctttcgtggtattcttgctagttacactagccatccttactgcgcttcgattgtgtgcgtactgctgcaatattgttaacgtgagtcttgtaaaaccttctttttacgtttactctcgtgttaaaaatctgaattcttctagagttcctgatcttctggtctaa
>Coronavirus.MN908947_NY1-PV08001.M
atggcagattccaacggtactattaccgttgaagagcttaaaaagctccttgaacaatggaacctagtaataggtttcctattccttacatggatttgtcttctacaatttgcctatgccaacaggaataggtttttgtatataattaagttaattttcctctggctgttatggccagtaactttagcttgttttgtgcttgctgctgtttacagaataaattggatcaccggtggaattgctatcgcaatggcttgtcttgtaggcttgatgtggctcagctacttcattgcttctttcagactgtttgcgcgtacgcgttccatgtggtcattcaatccagaaactaacattcttctcaacgtgccactccatggcactattctgaccagaccgcttctagaaagtgaactcgtaatcggagctgtgatccttcgtggacatcttcgtattgctggacaccatctaggacgctgtgacatcaaggacctgcctaaagaaatcactgttgctacatcacgaacgctttcttattacaaattgggagcttcgcagcgtgtagcaggtgactcaggttttgctgcatacagtcgctacaggattggcaactataaattaaacacagaccattccagtagcagtgacaatattgctttgcttgtacagtaa
>Coronavirus.MN908947_NY1-PV08001.N
atgtctgataatggaccccaaaatcagcgaaatgcaccccgcattacgtttggtggaccctcagattcaactggcagtaaccagaatggagaacgcagtggggcgcgatcaaaacaacgtcggccccaaggtttacccaataatactgcgtcttggttcaccgctctcactcaacatggcaaggaagaccttaaattccctcgaggacaaggcgttccaattaacaccaatagcagtccagatgaccaaattggctactaccgaagagctaccagacgaattcgtggtggtgacggtaaaatgaaagatctcagtccaagatggtatttctactacctaggaactgggccagaagctggacttccctatggtgctaacaaagacggcatcatatgggttgcaactgagggagccttgaatacaccaaaagatcacattggcacccgcaatcctgctaacaatgctgcaatcgtgctacaacttcctcaaggaacaacattgccaaaaggcttctacgcagaagggagcagaggcggcagtcaagcctcttctcgttcctcatcacgtagtcgcaacagttcaagaaattcaactccaggcagcagtaggggaacttctcctgctagaatggctggcaatggcggtgatgctgctcttgctttgctgctgcttgacagattgaaccagcttgagagcaaaatgtctggtaaaggccaacaacaacaaggccaaactgtcactaagaaatctgctTctgaggcttctaagaagcctcggcaaaaacgtactgccactaaagcatacaatgtaacacaagctttcggcagacgtggtccagaacaaacccaaggaaattttggggaccaggaactaatcagacaaggaactgattacaaacattggccgcaaattgcacaatttgcccccagcgcttcagcgttcttcggaatgtcgcgcattggcatggaagtcacaccttcgggaacgtggttgacctacacaggtgccatcaaattggatgacaaagatccaaatttcaaagatcaagtcattttgctgaataagcatattgacgcatacaaaacattcccaccaacagagcctaaaaaggacaaaaagaagaaggctgatgaaactcaagccttaccgcagagacagaagaaacagcaaactgtgactcttcttcctgctgcagatttggatgatttctccaaacaattgcaacaatccatgagcagtgctgactcaactcaggcctaa
>Coronavirus.MN908947_NY1-PV08001.ORF10
atgggctatataaacgttttcgcttttccgtttacgatatatagtctactcttgtgcagaatgaattctcgtaactacatagcacaagtagatgtagttaactttaatctcacatag
>Coronavirus.MN908947_NY1-PV08001.ORF3a
atggatttgtttatgagaatcttcacaattggaactgtaactttgaagcaaggtgaaatcaaggatgctactccttcagattttgttcgcgctactgcaacgataccgatacaagcctcactccctttcggatggcttattgttggcgttgcacttcttgctgtttttcagagcgcttccaaaatcataaccctcaaaaagagatggcaactagcactctccaagggtgttcactttgtttgcaacttgctgttgttgtttgtaacagtttactcacaccttttgctcgttgctgctggccttgaagccccttttctctatctttatgctttagtctacttcttgcagagtataaactttgtaagaataataatgaggctttggctttgctggaaatgccgttccaaaaacccattactttatgatgccaactattttctttgctggcatactaattgttacgactattgtataccttacaatagtgtaacttcttcaattgtcattacttcaggtgatggcacaacaagtcctatttctgaacatgactaccagattggtggttatactgaaaaatgggaatctggagtaaaagactgtgttgtattacacagttacttcacttcagactattaccagctgtactcaactcaattgagtacagacactggtgttgaacatgttaccttcttcatctacaataaaattgttgatgagcctgaagaacatgtccaaattcacacaatcgacggttcatccggagttgttaatccagtaatggaaccaatttatgatgaaccgacgacgactactagcgtgcctttgtaa
>Coronavirus.MN908947_NY1-PV08001.ORF6
atgtttcatctcgttgactttcaggttactatagcagagatattactaattattatgaggacttttaaagtttccatttggaatcttgattacatcataaacctcataattaaaaatttatctaagtcactaactgagaataaatattctcaattagatgaagagcaaccaatggagattgattaa
>Coronavirus.MN908947_NY1-PV08001.ORF7a
atgaaaattattcttttcttggcactgataacactcgctacttgtgagctttatcactaccaagagtgtgttagaggtacaacagtacttttaaaagaaccttgctcttctggaacatacgagggcaattcaccatttcatcctctagctgataacaaatttgcactgacttgctttagcactcaatttgcttttgcttgtcctgacggcgtaaaacacgtctatcagttacgtgccagatcagtttcacctaaactgttcatcagacaagaggaagttcaagaactttactctccaatttttcttattgttgcggcaatagtgtttataacactttgcttcacactcaaaagaaagacagaatga
>Coronavirus.MN908947_NY1-PV08001.ORF8
atgaaatttcttgttttcttaggaatcatcacaactgtagctgcatttcaccaagaatgtagtttacagtcatgtactcaacatcaaccatatgtagttgatgacccgtgtcctattcacttctattctaaatggtatattagagtaggagctagaaaatcagcacctttaattgaattgtgcgtggatgaggctggttctaaatcacccattcagtacatcgatatcggtaattatacagtttcctgtttaccttttacaattaattgccaggaacctaaattgggtagtcttgtagtgcgttgttcgttctatgaagactttttagagtatcatgacgttcgtgttgttttagatttcatctaa
>Coronavirus.MN908947_NY1-PV08001.S
atgtttgtttttcttgttttattgccactagtctctagtcagtgtgttaatcttacaaccagaactcaattaccccctgcatacactaattctttcacacgtggtgtttattaccctgacaaagttttcagatcctcagttttacattcaactcaggacttgttcttacctttcttttccaatgttacttggttccatgctatacatgtctctgggaccaatggtactaagaggtttgataaccctgtcctaccatttaatgatggtgtttattttgcttccactgagaagtctaacataataagaggctggatttttggtactactttagattcgaagacccagtccctacttattgttaataacgctactaatgttgttattaaagtctgtgaatttcaattttgtaatgatccatttttgggtgtttattaccacaaaaacaacaaaagttggatggaaagtgagttcagagtttattctagtgcgaataattgcacttttgaatatgtctctcagccttttcttatggaccttgaaggaaaacagggtaatttcaaaaatcttagggaatttgtgtttaagaatattgatggttattttaaaatatattctaagcacacgcctattaatttagtgcgtgatctccctcagggtttttcggctttagaaccattggtagatttgccaataggtattaacatcactaggtttcaaactttacttgctttacatagaagttatttgactcctggtgattcttcttcaggttggacagctggtgctgcagcttattatgtgggttatcttcaacctaggacttttctattaaaatataatgaaaatggaaccattacagatgctgtagactgtgcacttgaccctctctcagaaacaaagtgtacgttgaaatccttcactgtagaaaaaggaatctatcaaacttctaactttagagtccaaccaacagaatctattgttagatttcctaatattacaaacttgtgcccttttggtgaagtttttaacgccaccagatttgcatctgtttatgcttggaacaggaagagaatcagcaactgtgttgctgattattctgtcctatataattccgcatcattttccacttttaagtgttatggagtgtctcctactaaattaaatgatctctgctttactaatgtctatgcagattcatttgtaattagaggtgatgaagtcagacaaatcgctccagggcaaactggaaagattgctgattataattataaattaccagatgattttacaggctgcgttatagcttggaattctaacaatcttgattctaaggttggtggtaattataattacctgtatagattgtttaggaagtctaatctcaaaccttttgagagagatatttcaactgaaatctatcaggccggtagcacaccttgtaatggtgttgaaggttttaattgttactttcctttacaatcatatggtttccaacccactaatggtgttggttaccaaccatacagagtagtagtactttcttttgaacttctacatgcaccagcaactgtttgtggacctaaaaagtctactaatttggttaaaaacaaatgtgtcaatttcaacttcaatggtttaacaggcacaggtgttcttactgagtctaacaaaaagtttctgcctttccaacaatttggcagagacattgctgacactactgatgctgtccgtgatccacagacacttgagattcttgacattacaccatgttcttttggtggtgtcagtgttataacaccaggaacaaatacttctaaccaggttgctgttctttatcaggatgttaactgcacagaagtccctgttgctattcatgcagatcaacttactcctacttggcgtgtttattctacaggttctaatgtttttcaaacacgtgcaggctgtttaataggggctgaacatgtcaacaactcatatgagtgtgacatacccattggtgcaggtatatgcgctagttatcagactcagactaattctcctcggcgggcacgtagtgtagctagtcaatccatcattgcctacactatgtcacttggtgcagaaaattcagttgcttactctaataactctattgccatacccacaaattttactattagtgttaccacagaaattctaccagtgtctatgaccaagacatcagtagattgtacaatgtacatttgtggtgattcaactgaatgcagcaatcttttgttgcaatatggcagtttttgtacacaattaaaccgtgctttaactggaatagctgttgaacaagacaaaaacacccaagaagtttttgcacaagtcaaacaaatttacaaaacaccaccaattaaagattttggtggttttaatttttcacaaatattaccagatccatcaaaaccaagcaagaggtcatttattgaagatctacttttcaacaaagtgacacttgcagatgctggcttcatcaaacaatatggtgattgccttggtgatattgctgctagagacctcatttgtgcacaaaagtttaacggccttactgttttgccacctttgctcacagatgaaatgattgctcaatacacttctgcactgttagcgggtacaatcacttctggttggacctttggtgcaggtgctgcattacaaataccatttgctatgcaaatggcttataggtttaatggtattggagttacacagaatgttctctatgagaaccaaaaattgattgccaaccaatttaatagtgctattggcaaaattcaagactcactttcttccacagcaagtgcacttggaaaacttcaagatgtggtcaaccaaaatgcacaagctttaaacacgcttgttaaacaacttagctccaattttggtgcaatttcaagtgttttaaatgatatcctttcacgtcttgacaaagttgaggctgaagtgcaaattgataggttgatcacaggcagacttcaaagtttgcagacatatgtgactcaacaattaattagagctgcagaaatcagagcttctgctaatcttgctgctactaaaatgtcagagtgtgtacttggacaatcaaaaagagttgatttttgtggaaagggctatcatcttatgtccttccctcagtcagcacctcatggtgtagtcttcttgcatgtgacttatgtccctgcacaagaaaagaacttcacaactgctcctgccatttgtcatgatggaaaagcacactttcctcgtgaaggtgtctttgtttcaaatggcacacactggtttgtaacacaaaggaatttttatgaaccacaaatcattactacagacaacacatttgtgtctggtaactgtgatgttgtaataggaattgtcaacaacacagtttatgatcctttgcaacctgaattagactcattcaaggaggagttagataaatattttaagaatcatacatcaccagatgttgatttaggtgacatctctggcattaatgcttcagttgtaaacattcaaaaagaaattgaccgcctcaatgaggttgccaagaatttaaatgaatctctcatcgatctccaagaacttggaaagtatgagcagtatataaaatggccatggtacatttggTtaggttttatagctggcttgattgccatagtaatggtgacaattatgctttgctgtatgaccagttgctgtagttgtctcaagggctgttgttcttgtggatcctgctgcaaatttgatgaagacgactctgagccagtgctcaaaggagtcaaattacattacacataa
GuideName,GuideSeq,MatchPos,GuideScores,Rank,standardizedGuideScores,quartiles
crRNA154:154-176,TTAAAATCACATGGGGATAGCAC,176,1.22318095505026,0.9944,0.838172842499005,4
crRNA124:124-146,ATTAATTTTACACATTAGGGCTC,146,1.06256164788164,0.9888,0.748972356039623,4
crRNA080:80-102,TAGCATTGTTCACTGTACACTCG,102,1.02213083425242,0.9831,0.726518964182511,4
crRNA079:79-101,AGCATTGTTCACTGTACACTCGA,101,1.01558106700794,0.9775,0.722881528343059,4
crRNA153:153-175,TAAAATCACATGGGGATAGCACT,175,0.980840911833357,0.9719,0.703588463294571,4
crRNA155:155-177,ATTAAAATCACATGGGGATAGCA,177,0.977150986763281,0.9663,0.701539250674672,4
crRNA122:122-144,TAATTTTACACATTAGGGCTCTT,144,0.971264989192168,0.9607,0.698270441613686,4
crRNA078:78-100,GCATTGTTCACTGTACACTCGAT,100,0.959934045373096,0.9551,0.691977762865893,4
crRNA151:151-173,AAATCACATGGGGATAGCACTAC,173,0.944178160623081,0.9494,0.683227677903668,4
crRNA150:150-172,AATCACATGGGGATAGCACTACT,172,0.94057114017546,0.9438,0.681224506651914,4
crRNA102:102-124,CTTCCATATAGGCAGCTCTCCCT,124,0.9350373475529,0.9382,0.678151295824405,4
crRNA105:105-127,GCTCTTCCATATAGGCAGCTCTC,127,0.934869749279777,0.9326,0.678058219545121,4
crRNA011:11-33,TCCTCCCTAATGTTACACACTGA,33,0.929098941937749,0.927,0.674853381775326,4
crRNA123:123-145,TTAATTTTACACATTAGGGCTCT,145,0.91827151339797,0.9213,0.668840331975289,4
crRNA066:66-88,GTACACTCGATCGTACTCCGCGT,88,0.917774819671757,0.9157,0.668564491400575,4
crRNA149:149-171,ATCACATGGGGATAGCACTACTA,171,0.905724150468831,0.9101,0.661872110677418,4
crRNA120:120-142,ATTTTACACATTAGGGCTCTTCC,142,0.898774966749871,0.9045,0.65801285752066,4
crRNA121:121-143,AATTTTACACATTAGGGCTCTTC,143,0.891563317222564,0.8989,0.654007843071588,4
crRNA103:103-125,TCTTCCATATAGGCAGCTCTCCC,125,0.885989946105193,0.8933,0.650912652190417,4
crRNA100:100-122,TCCATATAGGCAGCTCTCCCTAG,122,0.88175742619036,0.8876,0.648562107651237,4
crRNA041:41-63,CCTCGGTGAAAATGTGGTGGCTC,63,0.87692667568868,0.882,0.645879333691433,4
crRNA039:39-61,TCGGTGAAAATGTGGTGGCTCTT,61,0.87430413287207,0.8764,0.644422895489041,4
crRNA099:99-121,CCATATAGGCAGCTCTCCCTAGC,121,0.857447871032286,0.8708,0.635061712313117,4
crRNA097:97-119,ATATAGGCAGCTCTCCCTAGCAT,119,0.852803423160492,0.8652,0.632482402161664,4
crRNA070:70-92,CACTGTACACTCGATCGTACTCC,92,0.852473008151469,0.8596,0.632298905046293,4
crRNA119:119-141,TTTTACACATTAGGGCTCTTCCA,141,0.846217291780852,0.8539,0.628824771374274,4
crRNA067:67-89,TGTACACTCGATCGTACTCCGCG,89,0.843878907872524,0.8483,0.627526141802098,4
crRNA083:83-105,CCCTAGCATTGTTCACTGTACAC,105,0.84044856135252,0.8427,0.625621087025667,4
crRNA037:37-59,GGTGAAAATGTGGTGGCTCTTTC,59,0.833908679899921,0.8371,0.621989141294846,4
crRNA156:156-178,TATTAAAATCACATGGGGATAGC,178,0.827630683916203,0.8315,0.618502634562814,4
crRNA040:40-62,CTCGGTGAAAATGTGGTGGCTCT,62,0.824559111539421,0.8258,0.616796826244786,4
crRNA068:68-90,CTGTACACTCGATCGTACTCCGC,90,0.824066538851126,0.8202,0.6165232743027,4
crRNA109:109-131,TAGGGCTCTTCCATATAGGCAGC,131,0.822685493627261,0.8146,0.615756306072275,4
crRNA077:77-99,CATTGTTCACTGTACACTCGATC,99,0.816793586742935,0.809,0.612484215253806,4
crRNA127:127-149,AAAATTAATTTTACACATTAGGG,149,0.815613807124364,0.8034,0.611829020571757,4
crRNA081:81-103,CTAGCATTGTTCACTGTACACTC,103,0.800453810484474,0.7978,0.603409864127624,4
crRNA157:157-179,CTATTAAAATCACATGGGGATAG,179,0.799453305479583,0.7921,0.602854230220876,4
crRNA104:104-126,CTCTTCCATATAGGCAGCTCTCC,126,0.784188834329561,0.7865,0.594377053497048,4
crRNA108:108-130,AGGGCTCTTCCATATAGGCAGCT,130,0.782229109778379,0.7809,0.593288713705442,4
crRNA069:69-91,ACTGTACACTCGATCGTACTCCG,91,0.77571003564019,0.7753,0.589668323388475,4
crRNA075:75-97,TTGTTCACTGTACACTCGATCGT,97,0.774374187263412,0.7697,0.588926455383033,4
crRNA101:101-123,TTCCATATAGGCAGCTCTCCCTA,123,0.765832754062761,0.764,0.584182940982498,3
crRNA082:82-104,CCTAGCATTGTTCACTGTACACT,104,0.761311749521024,0.7584,0.581672185510339,3
crRNA065:65-87,TACACTCGATCGTACTCCGCGTG,87,0.759749618545954,0.7528,0.580804650683139,3
crRNA060:60-82,TCGATCGTACTCCGCGTGGCCTC,82,0.752529072293029,0.7472,0.576794695406796,3
crRNA074:74-96,TGTTCACTGTACACTCGATCGTA,96,0.744672313356596,0.7416,0.57243141722139,3
crRNA162:162-184,AGAAGCTATTAAAATCACATGGG,184,0.737650930802102,0.736,0.568532068192193,3
crRNA073:73-95,GTTCACTGTACACTCGATCGTAC,95,0.737258621872358,0.7303,0.568314198074382,3
crRNA059:59-81,CGATCGTACTCCGCGTGGCCTCG,81,0.734455724742754,0.7247,0.566757599481949,3
crRNA010:10-32,CCTCCCTAATGTTACACACTGAT,32,0.733257977203616,0.7191,0.566092426253213,3
crRNA038:38-60,CGGTGAAAATGTGGTGGCTCTTT,60,0.729162887135293,0.7135,0.563818203853499,3
crRNA160:160-182,AAGCTATTAAAATCACATGGGGA,182,0.716225488343236,0.7079,0.556633374793323,3
crRNA061:61-83,CTCGATCGTACTCCGCGTGGCCT,83,0.710248786499836,0.7022,0.553314192801744,3
crRNA106:106-128,GGCTCTTCCATATAGGCAGCTCT,128,0.706712679655432,0.6966,0.551350403664228,3
crRNA128:128-150,TAAAATTAATTTTACACATTAGG,150,0.706646702409236,0.691,0.551313762972895,3
crRNA024:24-46,TGGCTCTTTCAAGTCCTCCCTAA,46,0.706443351540373,0.6854,0.551200831366202,3
crRNA163:163-185,AAGAAGCTATTAAAATCACATGG,185,0.704126699854418,0.6798,0.549914270858709,3
crRNA126:126-148,AAATTAATTTTACACATTAGGGC,148,0.702804572422277,0.6742,0.549180022827216,3
crRNA158:158-180,GCTATTAAAATCACATGGGGATA,180,0.699618022334808,0.6685,0.547410361240823,3
crRNA064:64-86,ACACTCGATCGTACTCCGCGTGG,86,0.67431453967055,0.6629,0.533357984832557,3
crRNA110:110-132,TTAGGGCTCTTCCATATAGGCAG,132,0.66345123275346,0.6573,0.52732500985188,3
crRNA012:12-34,GTCCTCCCTAATGTTACACACTG,34,0.659870058250853,0.6517,0.525336192234872,3
crRNA107:107-129,GGGCTCTTCCATATAGGCAGCTC,129,0.659182937405583,0.6461,0.524954597302514,3
crRNA161:161-183,GAAGCTATTAAAATCACATGGGG,183,0.64988016355947,0.6404,0.519788269747485,3
crRNA159:159-181,AGCTATTAAAATCACATGGGGAT,181,0.634415618920259,0.6348,0.511199981521075,3
crRNA025:25-47,GTGGCTCTTTCAAGTCCTCCCTA,47,0.628933160339319,0.6292,0.508155279230709,3
crRNA030:30-52,ATGTGGTGGCTCTTTCAAGTCCT,52,0.614731496103382,0.6236,0.500268335993876,3
crRNA098:98-120,CATATAGGCAGCTCTCCCTAGCA,120,0.612308704179231,0.618,0.498922830138859,3
crRNA125:125-147,AATTAATTTTACACATTAGGGCT,147,0.60878773342223,0.6124,0.49696744687971,3
crRNA058:58-80,GATCGTACTCCGCGTGGCCTCGG,80,0.584256410114044,0.6067,0.483343891834205,3
crRNA057:57-79,ATCGTACTCCGCGTGGCCTCGGT,79,0.58321573430477,0.6011,0.482765948932632,3
crRNA118:118-140,TTTACACATTAGGGCTCTTCCAT,140,0.564985576754435,0.5955,0.472641768033172,3
crRNA056:56-78,TCGTACTCCGCGTGGCCTCGGTG,78,0.560111345901391,0.5899,0.469934847110207,3
crRNA028:28-50,GTGGTGGCTCTTTCAAGTCCTCC,50,0.543296775705029,0.5843,0.460596817532316,3
crRNA087:87-109,CTCTCCCTAGCATTGTTCACTGT,109,0.539318158541777,0.5787,0.458387278762328,3
crRNA076:76-98,ATTGTTCACTGTACACTCGATCG,98,0.53162535111965,0.573,0.454115051616113,3
crRNA084:84-106,TCCCTAGCATTGTTCACTGTACA,106,0.526259741672101,0.5674,0.451135241895168,3
crRNA062:62-84,ACTCGATCGTACTCCGCGTGGCC,84,0.524271046524178,0.5618,0.450030813182698,3
crRNA071:71-93,TCACTGTACACTCGATCGTACTC,93,0.51732555380046,0.5562,0.446173609832883,3
crRNA096:96-118,TATAGGCAGCTCTCCCTAGCATT,118,0.514271950452566,0.5506,0.444477780677051,3
crRNA085:85-107,CTCCCTAGCATTGTTCACTGTAC,107,0.507964182844037,0.5449,0.440974740170452,3
crRNA088:88-110,GCTCTCCCTAGCATTGTTCACTG,110,0.489694394967384,0.5393,0.430828550432525,3
crRNA152:152-174,AAAATCACATGGGGATAGCACTA,174,0.486073636117259,0.5337,0.428817749511536,3
crRNA063:63-85,CACTCGATCGTACTCCGCGTGGC,85,0.477451688588436,0.5281,0.424029521201033,3
crRNA036:36-58,GTGAAAATGTGGTGGCTCTTTCA,58,0.468760156996718,0.5225,0.419202649141098,3
crRNA054:54-76,GTACTCCGCGTGGCCTCGGTGAA,76,0.464053481802544,0.5169,0.416588780831444,3
crRNA072:72-94,TTCACTGTACACTCGATCGTACT,94,0.457896518793822,0.5112,0.413169490179705,3
crRNA053:53-75,TACTCCGCGTGGCCTCGGTGAAA,75,0.456458785228318,0.5056,0.412371039883146,3
crRNA029:29-51,TGTGGTGGCTCTTTCAAGTCCTC,51,0.450010358175187,0.5,0.408789883668636,3
crRNA027:27-49,TGGTGGCTCTTTCAAGTCCTCCC,49,0.439151438085324,0.4944,0.402759344927597,3
crRNA112:112-134,CATTAGGGCTCTTCCATATAGGC,134,0.430476827899924,0.4888,0.397941870229049,3
crRNA014:14-36,AAGTCCTCCCTAATGTTACACAC,36,0.413767400953254,0.4831,0.388662232317675,3
crRNA023:23-45,GGCTCTTTCAAGTCCTCCCTAAT,45,0.411305856151417,0.4775,0.387295204918317,3
crRNA026:26-48,GGTGGCTCTTTCAAGTCCTCCCT,48,0.411085709919141,0.4719,0.387172945948599,3
crRNA113:113-135,ACATTAGGGCTCTTCCATATAGG,135,0.401910701440688,0.4663,0.38207757333136,3
crRNA095:95-117,ATAGGCAGCTCTCCCTAGCATTG,117,0.399858940356431,0.4607,0.380938120733535,3
crRNA052:52-74,ACTCCGCGTGGCCTCGGTGAAAA,74,0.399434236836116,0.4551,0.380702260168071,3
crRNA055:55-77,CGTACTCCGCGTGGCCTCGGTGA,77,0.38722335890422,0.4494,0.373920906974475,3
crRNA045:45-67,GTGGCCTCGGTGAAAATGTGGTG,67,0.380312490929197,0.4438,0.370082932598322,3
crRNA117:117-139,TTACACATTAGGGCTCTTCCATA,139,0.369225243857684,0.4382,0.363925591680172,3
crRNA031:31-53,AATGTGGTGGCTCTTTCAAGTCC,53,0.367837008050436,0.4326,0.363154630134453,3
crRNA092:92-114,GGCAGCTCTCCCTAGCATTGTTC,114,0.362422383585791,0.427,0.360147599754637,3
crRNA042:42-64,GCCTCGGTGAAAATGTGGTGGCT,64,0.355993986301248,0.4213,0.356577567141226,3
crRNA051:51-73,CTCCGCGTGGCCTCGGTGAAAAT,73,0.341945732167693,0.4157,0.348775820734098,3
crRNA129:129-151,CTAAAATTAATTTTACACATTAG,151,0.331642250039806,0.4101,0.343053746381803,3
crRNA015:15-37,CAAGTCCTCCCTAATGTTACACA,37,0.324914434746087,0.4045,0.339317430943842,3
crRNA022:22-44,GCTCTTTCAAGTCCTCCCTAATG,44,0.323965567047399,0.3989,0.338790473993271,3
crRNA021:21-43,CTCTTTCAAGTCCTCCCTAATGT,43,0.321294749912195,0.3933,0.337307226481474,3
crRNA086:86-108,TCTCCCTAGCATTGTTCACTGTA,108,0.314430054224523,0.3876,0.333494894044422,3
crRNA013:13-35,AGTCCTCCCTAATGTTACACACT,35,0.299827012793918,0.382,0.325385044597562,3
crRNA008:8-30,TCCCTAATGTTACACACTGATTA,30,0.290863471375531,0.3764,0.320407110941806,2
crRNA044:44-66,TGGCCTCGGTGAAAATGTGGTGG,66,0.277075947646272,0.3708,0.312750162064364,2
crRNA116:116-138,TACACATTAGGGCTCTTCCATAT,138,0.272416756052639,0.3652,0.310162663936115,2
crRNA089:89-111,AGCTCTCCCTAGCATTGTTCACT,111,0.268502666575276,0.3596,0.307988960839141,2
crRNA148:148-170,TCACATGGGGATAGCACTACTAA,170,0.267749074038432,0.3539,0.307570450623503,2
crRNA164:164-186,TAAGAAGCTATTAAAATCACATG,186,0.267116077153046,0.3483,0.307218913619023,2
crRNA009:9-31,CTCCCTAATGTTACACACTGATT,31,0.265558076503519,0.3427,0.306353672582365,2
crRNA047:47-69,GCGTGGCCTCGGTGAAAATGTGG,69,0.263451524078151,0.3371,0.305183791424195,2
crRNA046:46-68,CGTGGCCTCGGTGAAAATGTGGT,68,0.255095775791555,0.3315,0.300543397781393,2
crRNA176:176-198,TTGTCATTCTCCTAAGAAGCTAT,198,0.248809124206009,0.3258,0.297052084131019,2
crRNA043:43-65,GGCCTCGGTGAAAATGTGGTGGC,65,0.246655609045284,0.3202,0.295856122055721,2
crRNA177:177-199,TTTGTCATTCTCCTAAGAAGCTA,199,0.243824850560793,0.3146,0.294284050563715,2
crRNA175:175-197,TGTCATTCTCCTAAGAAGCTATT,197,0.201353133964844,0.309,0.270697236201812,2
crRNA178:178-200,TTTTGTCATTCTCCTAAGAAGCT,200,0.198655914110779,0.3034,0.269199325848994,2
crRNA035:35-57,TGAAAATGTGGTGGCTCTTTCAA,57,0.194877743093624,0.2978,0.267101105537887,2
crRNA111:111-133,ATTAGGGCTCTTCCATATAGGCA,133,0.187083036839602,0.2921,0.262772288523773,2
crRNA016:16-38,TCAAGTCCTCCCTAATGTTACAC,38,0.183895785588279,0.2865,0.261002237543614,2
crRNA033:33-55,AAAATGTGGTGGCTCTTTCAAGT,55,0.18335978193541,0.2809,0.260704566065492,2
crRNA034:34-56,GAAAATGTGGTGGCTCTTTCAAG,56,0.167388411093818,0.2753,0.251834810158765,2
crRNA114:114-136,CACATTAGGGCTCTTCCATATAG,136,0.166832176996468,0.2697,0.251525903633494,2
crRNA032:32-54,AAATGTGGTGGCTCTTTCAAGTC,54,0.15564366692578,0.264,0.24531232595934,2
crRNA048:48-70,CGCGTGGCCTCGGTGAAAATGTG,70,0.134344995237605,0.2584,0.233484035145401,2
crRNA020:20-42,TCTTTCAAGTCCTCCCTAATGTT,42,0.13306073914269,0.2528,0.232770819091713,2
crRNA050:50-72,TCCGCGTGGCCTCGGTGAAAATG,72,0.13011477708323,0.2472,0.231134768896834,2
crRNA094:94-116,TAGGCAGCTCTCCCTAGCATTGT,116,0.113345203345294,0.2416,0.221821728257392,2
crRNA090:90-112,CAGCTCTCCCTAGCATTGTTCAC,112,0.0977856938877462,0.236,0.213180700991438,2
crRNA093:93-115,AGGCAGCTCTCCCTAGCATTGTT,115,0.092779332628538,0.2303,0.210400400991489,2
crRNA115:115-137,ACACATTAGGGCTCTTCCATATA,137,0.0561868757802544,0.2247,0.190078653817072,2
crRNA147:147-169,CACATGGGGATAGCACTACTAAA,169,0.0346791253416698,0.2191,0.178134250397658,2
crRNA091:91-113,GCAGCTCTCCCTAGCATTGTTCA,113,0.0309296915730088,0.2135,0.176051989416663,2
crRNA049:49-71,CCGCGTGGCCTCGGTGAAAATGT,71,0.0286492386534559,0.2079,0.174785532018996,2
crRNA130:130-152,ACTAAAATTAATTTTACACATTA,152,-0.0231146675867972,0.2022,0.146038268075061,1
crRNA131:131-153,TACTAAAATTAATTTTACACATT,153,-0.0312180300104384,0.1966,0.141538037792118,1
crRNA001:1-23,TGTTACACACTGATTAAAGATTG,23,-0.0359227009180383,0.191,0.138925282569929,1
crRNA134:134-156,CACTACTAAAATTAATTTTACAC,156,-0.0418209387906494,0.1854,0.135649675815271,1
crRNA017:17-39,TTCAAGTCCTCCCTAATGTTACA,39,-0.0500002423499235,0.1798,0.131107271360617,1
crRNA007:7-29,CCCTAATGTTACACACTGATTAA,29,-0.051344619547864,0.1742,0.130360666844914,1
crRNA132:132-154,CTACTAAAATTAATTTTACACAT,154,-0.0514165230222987,0.1685,0.130320735002281,1
crRNA133:133-155,ACTACTAAAATTAATTTTACACA,155,-0.0514218419718493,0.1629,0.130317781105294,1
crRNA146:146-168,ACATGGGGATAGCACTACTAAAA,168,-0.0557178117908316,0.1573,0.127931999442908,1
crRNA166:166-188,CCTAAGAAGCTATTAAAATCACA,188,-0.0588767421144539,0.1517,0.12617767658767,1
crRNA143:143-165,TGGGGATAGCACTACTAAAATTA,165,-0.0591468767642662,0.1461,0.126027656377787,1
crRNA135:135-157,GCACTACTAAAATTAATTTTACA,157,-0.0606674281615796,0.1404,0.125183212912566,1
crRNA167:167-189,TCCTAAGAAGCTATTAAAATCAC,189,-0.0667474541842162,0.1348,0.121806649481524,1
crRNA005:5-27,CTAATGTTACACACTGATTAAAG,27,-0.0700848275330639,0.1292,0.119953227676502,1
crRNA141:141-163,GGGATAGCACTACTAAAATTAAT,163,-0.0737970797460305,0.1236,0.117891615600758,1
crRNA006:6-28,CCTAATGTTACACACTGATTAAA,28,-0.0738988021536582,0.118,0.117835123710685,1
crRNA165:165-187,CTAAGAAGCTATTAAAATCACAT,187,-0.0741313779770003,0.1124,0.11770596192468,1
crRNA145:145-167,CATGGGGATAGCACTACTAAAAT,167,-0.0750731792538359,0.1067,0.117182929335866,1
crRNA136:136-158,AGCACTACTAAAATTAATTTTAC,158,-0.0760677354933736,0.1011,0.116630599096483,1
crRNA137:137-159,TAGCACTACTAAAATTAATTTTA,159,-0.0763641746652363,0.09551,0.116465970579514,1
crRNA142:142-164,GGGGATAGCACTACTAAAATTAA,164,-0.0772096411502582,0.08989,0.115996437849742,1
crRNA140:140-162,GGATAGCACTACTAAAATTAATT,162,-0.0794736458178233,0.08427,0.114739115045572,1
crRNA004:4-26,TAATGTTACACACTGATTAAAGA,26,-0.0795070148356009,0.07865,0.114720583446408,1
crRNA003:3-25,AATGTTACACACTGATTAAAGAT,25,-0.083683030968132,0.07303,0.112401418477697,1
crRNA018:18-40,TTTCAAGTCCTCCCTAATGTTAC,40,-0.0841488743094267,0.06742,0.112142710770698,1
crRNA138:138-160,ATAGCACTACTAAAATTAATTTT,160,-0.0872384498387389,0.0618,0.110426904339792,1
crRNA139:139-161,GATAGCACTACTAAAATTAATTT,161,-0.0879491325937303,0.05618,0.110032224219568,1
crRNA144:144-166,ATGGGGATAGCACTACTAAAATT,166,-0.089301116109456,0.05056,0.109281395509037,1
crRNA002:2-24,ATGTTACACACTGATTAAAGATT,24,-0.090644064827432,0.04494,0.108535584304612,1
crRNA170:170-192,TTCTCCTAAGAAGCTATTAAAAT,192,-0.102497307129306,0.03933,0.101952845292184,1
crRNA019:19-41,CTTTCAAGTCCTCCCTAATGTTA,41,-0.11793670850287,0.03371,0.0933785204651084,1
crRNA174:174-196,GTCATTCTCCTAAGAAGCTATTA,196,-0.128172644274293,0.02809,0.0876939582149465,1
crRNA168:168-190,CTCCTAAGAAGCTATTAAAATCA,190,-0.128510513872423,0.02247,0.0875063211677922,1
crRNA173:173-195,TCATTCTCCTAAGAAGCTATTAA,195,-0.138824758111673,0.01685,0.0817782700398161,1
crRNA169:169-191,TCTCCTAAGAAGCTATTAAAATC,191,-0.142431636024109,0.01124,0.0797751779454698,1
crRNA171:171-193,ATTCTCCTAAGAAGCTATTAAAA,193,-0.155037504184586,0.005618,0.0727744655655009,1
crRNA172:172-194,CATTCTCCTAAGAAGCTATTAAA,194,-0.197824525676736,0,0.0490125455415215,1
>1_0.8382_0.9944_Q4
TTAAAATCACATGGGGATAGCAC
>2_0.749_0.9888_Q4
ATTAATTTTACACATTAGGGCTC
>3_0.7265_0.9831_Q4
TAGCATTGTTCACTGTACACTCG
>4_0.7229_0.9775_Q4
AGCATTGTTCACTGTACACTCGA
>5_0.7036_0.9719_Q4
TAAAATCACATGGGGATAGCACT
>6_0.7015_0.9663_Q4
ATTAAAATCACATGGGGATAGCA
>7_0.6983_0.9607_Q4
TAATTTTACACATTAGGGCTCTT
>8_0.692_0.9551_Q4
GCATTGTTCACTGTACACTCGAT
>9_0.6832_0.9494_Q4
AAATCACATGGGGATAGCACTAC
>10_0.6812_0.9438_Q4
AATCACATGGGGATAGCACTACT
>11_0.6782_0.9382_Q4
CTTCCATATAGGCAGCTCTCCCT
>12_0.6781_0.9326_Q4
GCTCTTCCATATAGGCAGCTCTC
>13_0.6749_0.927_Q4
TCCTCCCTAATGTTACACACTGA
>14_0.6688_0.9213_Q4
TTAATTTTACACATTAGGGCTCT
>15_0.6686_0.9157_Q4
GTACACTCGATCGTACTCCGCGT
>16_0.6619_0.9101_Q4
ATCACATGGGGATAGCACTACTA
>17_0.658_0.9045_Q4
ATTTTACACATTAGGGCTCTTCC
>18_0.654_0.8989_Q4
AATTTTACACATTAGGGCTCTTC
>19_0.6509_0.8933_Q4
TCTTCCATATAGGCAGCTCTCCC
>20_0.6486_0.8876_Q4
TCCATATAGGCAGCTCTCCCTAG
>21_0.6459_0.882_Q4
CCTCGGTGAAAATGTGGTGGCTC
>22_0.6444_0.8764_Q4
TCGGTGAAAATGTGGTGGCTCTT
>23_0.6351_0.8708_Q4
CCATATAGGCAGCTCTCCCTAGC
>24_0.6325_0.8652_Q4
ATATAGGCAGCTCTCCCTAGCAT
>25_0.6323_0.8596_Q4
CACTGTACACTCGATCGTACTCC
>26_0.6288_0.8539_Q4
TTTTACACATTAGGGCTCTTCCA
>27_0.6275_0.8483_Q4
TGTACACTCGATCGTACTCCGCG
>28_0.6256_0.8427_Q4
CCCTAGCATTGTTCACTGTACAC
>29_0.622_0.8371_Q4
GGTGAAAATGTGGTGGCTCTTTC
>30_0.6185_0.8315_Q4
TATTAAAATCACATGGGGATAGC
>31_0.6168_0.8258_Q4
CTCGGTGAAAATGTGGTGGCTCT
>32_0.6165_0.8202_Q4
CTGTACACTCGATCGTACTCCGC
>33_0.6158_0.8146_Q4
TAGGGCTCTTCCATATAGGCAGC
>34_0.6125_0.809_Q4
CATTGTTCACTGTACACTCGATC
>35_0.6118_0.8034_Q4
AAAATTAATTTTACACATTAGGG
>36_0.6034_0.7978_Q4
CTAGCATTGTTCACTGTACACTC
>37_0.6029_0.7921_Q4
CTATTAAAATCACATGGGGATAG
>38_0.5944_0.7865_Q4
CTCTTCCATATAGGCAGCTCTCC
>39_0.5933_0.7809_Q4
AGGGCTCTTCCATATAGGCAGCT
>40_0.5897_0.7753_Q4
ACTGTACACTCGATCGTACTCCG
>41_0.5889_0.7697_Q4
TTGTTCACTGTACACTCGATCGT
>42_0.5842_0.764_Q3
TTCCATATAGGCAGCTCTCCCTA
>43_0.5817_0.7584_Q3
CCTAGCATTGTTCACTGTACACT
>44_0.5808_0.7528_Q3
TACACTCGATCGTACTCCGCGTG
>45_0.5768_0.7472_Q3
TCGATCGTACTCCGCGTGGCCTC
>46_0.5724_0.7416_Q3
TGTTCACTGTACACTCGATCGTA
>47_0.5685_0.736_Q3
AGAAGCTATTAAAATCACATGGG
>48_0.5683_0.7303_Q3
GTTCACTGTACACTCGATCGTAC
>49_0.5668_0.7247_Q3
CGATCGTACTCCGCGTGGCCTCG
>50_0.5661_0.7191_Q3
CCTCCCTAATGTTACACACTGAT
>51_0.5638_0.7135_Q3
CGGTGAAAATGTGGTGGCTCTTT
>52_0.5566_0.7079_Q3
AAGCTATTAAAATCACATGGGGA
>53_0.5533_0.7022_Q3
CTCGATCGTACTCCGCGTGGCCT
>54_0.5514_0.6966_Q3
GGCTCTTCCATATAGGCAGCTCT
>55_0.5513_0.691_Q3
TAAAATTAATTTTACACATTAGG
>56_0.5512_0.6854_Q3
TGGCTCTTTCAAGTCCTCCCTAA
>57_0.5499_0.6798_Q3
AAGAAGCTATTAAAATCACATGG
>58_0.5492_0.6742_Q3
AAATTAATTTTACACATTAGGGC
>59_0.5474_0.6685_Q3
GCTATTAAAATCACATGGGGATA
>60_0.5334_0.6629_Q3
ACACTCGATCGTACTCCGCGTGG
>61_0.5273_0.6573_Q3
TTAGGGCTCTTCCATATAGGCAG
>62_0.5253_0.6517_Q3
GTCCTCCCTAATGTTACACACTG
>63_0.525_0.6461_Q3
GGGCTCTTCCATATAGGCAGCTC
>64_0.5198_0.6404_Q3
GAAGCTATTAAAATCACATGGGG
>65_0.5112_0.6348_Q3
AGCTATTAAAATCACATGGGGAT
>66_0.5082_0.6292_Q3
GTGGCTCTTTCAAGTCCTCCCTA
>67_0.5003_0.6236_Q3
ATGTGGTGGCTCTTTCAAGTCCT
>68_0.4989_0.618_Q3
CATATAGGCAGCTCTCCCTAGCA
>69_0.497_0.6124_Q3
AATTAATTTTACACATTAGGGCT
>70_0.4833_0.6067_Q3
GATCGTACTCCGCGTGGCCTCGG
>71_0.4828_0.6011_Q3
ATCGTACTCCGCGTGGCCTCGGT
>72_0.4726_0.5955_Q3
TTTACACATTAGGGCTCTTCCAT
>73_0.4699_0.5899_Q3