add readme

Cas13designGuidePredictor/Readme.md

+# Cas13design v0.2
+
+This R software scores guide RNA for the RNA-targeting RfxCas13d CRISPR protein to maximize target knockdown efficacy.
+
+
+## Background
+
+The guide RNA efficacies are modeled using data from GFP, CD46, CD55, and CD71 mRNA tiling screens.
+For more information, please refer to our recent manuscript:
+
+Hans-Hermann Wessels\*, Alejandro Méndez-Mancilla\*, Xinyi Guo, Mateusz Legut, Zharko Daniloski, Neville E. Sanjana. 
+[***Massively parallel Cas13 screens reveal principles for guide RNA design***.](https://doi.org/10.1038/s41587-020-0456-9) Nature Biotechnology (2020)
+
+
+## Install
+
+To download and install the Cas13 guide RNA scoring software, please follow the instructions in Install.txt.
+```
+wget https://gitlab.com/sanjanalab/cas13/raw/master/Cas13design.tar.gz
+tar -xzf Cas13design.tar.gz
+cd Cas13design
+cat Install.txt
+```
+
+## Example
+
+In the follwoing section, I demonstrate how to predict guide RNA scores for custom target RNAs.
+As an example I choose to score guide RNAs to target the [Corona virus strain USA/NY1-PV08001/2020](https://nextstrain.org/ncov?c=location&f_division=New%20York&r=country). 
+This strain represents a close relative to the strain responsible for the recent Wuhan corona virus outbreak, bearing 3 nucleotide substitutions (G3243A, C25214T, G29027T) and two amino acid mutations (N: A252S, ORF1a: G993S).
+The positive-sense RNA virus contains 10 genes (ORF1ab, S, ORF3a, E, M, ORF6, ORF7a, ORF8, N, ORF10). 
+
+To predict guide RNA scores for these corona virus genes, first change directory into the Cas13design folder.
+The data directory contains the corona virus sequences separated into single entry FASTA files.
+
+
+```r
+# navigate to your Cas13design installation
+cd ~/path/to/Cas13design
+
+# find USA/NY1-PV08001/2020 corona virus sequences 
+ls -ltr ./data/*fasta
+
+```
+
+### Predict guide RNA scores
+
+Next, simply execute RfxCas13d_GuideScoring.R by providing 3 required input arguments:
+1. the target sequence as a single entry fasta file
+2. the model input data
+3. a true or false statement, if you would like the predctions to be plotted relative to the input sequence.
+
+```r
+
+# Predict guide RNA scores for the USA/NY1-PV08001/2020 S gene
+Rscript ./scripts/RfxCas13d_GuideScoring.R  ./data/MN908947_NY1-PV08001.S.fasta ./data/Cas13designGuidePredictorInput.csv true
+
+
+```
+
+If you run the script the first time, R package installation may take several minutes.
+Once Cas13design is fully installed, the run time scales with the fasta input length.
+Our software extracts all information needed from the target input sequence, including base probabilities, RNA-RNA hybridization energies, RNA target site accessibility or guide RNA folding.
+The minimum length supplied must be at least 30 nucleotides. The total run time for the provided ~1000nt test.fa example is about 2 min.
+
+
+### Output
+
+The output may be 3-fold and named after the fasta header information:
+1. 	A fasta file with guide sequences (reverse complement to the target sequence). 
+	The header includes the following information separated by underscores "_"
+		the crRNA number (5' to 3') and match position (e.g. crRNA1156:1399-1425)
+		standardized guide score
+		rank
+		quartile according to input screens
+2. 	A csv file containing all predicted guides
+3.  if plot was set to TRUE, a pdf file is returned depicting the score destribution along the target transcripts
+
+Guide scores range between a 0 - 1 interval, with higher scores being indicative for higher predicted knock-down efficacy. 
+
+
+| GuideName        | Sequence               | Position  |Score  | Rank   | Standardized score | Quartile |
+| -----------------|------------------------|-----------|------ |--------| :-----------------:| -------- |
+| crRNA0742:780-802| CCACATAATAAGCTGCAGCACCA| 802       |1.659  | 0.9997 | 1                  |4         |
+| crRNA0741:779-801| CACATAATAAGCTGCAGCACCAG| 801       |1.578  | 0.9994 | 1                  |4         |
+| ...              | ...                    |...        |...    | ...    |...                 |...       |
+
+
+Guide RNA prediction visualization:
+![alt text][predictions]
+
+[predictions]: https://gitlab.com/sanjanalab/cas13/-/blob/master/Cas13designGuidePredictor/data/ExampleS.png "USA/NY1-PV08001/2020 S gene"
+
+ 
+![alt text](./data/ExampleS.png "USA/NY1-PV08001/2020 S gene")
+
+
+
+
+
+### Bulk predictions
+
+To predict guide RNA scores for all corona virus genes, one can use a simple wrapper. In this case, all jobs are send as individual jobs to a computation cluster.
+
+```sh
+# This will submit one job per fasta file in the directory ./data/
+bash qsub_MakePredictions.sh ./data/
+```
+
+